748 articles
JAK-STAT signaling pathway
JAK-STAT signaling pathway: cytokine receptors activate Janus kinases (JAK1-3, TYK2) that phosphorylate STAT transcription factors, which dimerize and enter the nucleus. Discovered via interferon studies; regulated by SOCS, PIAS, phosphatases; linked to immune deficiency, leukemia, inflammation.
JASPAR
JASPAR is an open-access database of manually curated transcription factor binding profiles stored as PFMs, first released in 2004, with 2,633 CORE profiles in the 2026 release across six taxonomic groups, plus REST API, pyJASPAR, and Bioconductor access.
JUNB
JUNB (JunB proto-oncogene, AP-1 transcription factor subunit), on chromosome 19p13.13, encodes a ~35 kDa bZIP transcription factor of the AP-1 complex that represses c-Jun, negatively regulates proliferation, and acts as tumor suppressor or oncogene by context.
KCNQ1OT1
KCNQ1OT1 (Kcnq1 opposite strand/antisense transcript 1) is a ~60 kb paternally expressed antisense lncRNA on human chromosome 11p15.5 that silences imprinted genes in the Kcnq1 domain in cis and acts as an oncogenic miRNA sponge in cancers.
Kinetoplastid RNA editing
Kinetoplastid RNA editing is a post-transcriptional process in the mitochondria of trypanosomes and Leishmania, in which guide RNAs direct insertion and deletion of hundreds of uridines to convert untranslatable transcripts into mature mRNAs.
KMT2D
KMT2D (MLL2, MLL4) is a human chromosome 12 gene encoding a histone H3 lysine 4 methyltransferase that monomethylates enhancer H3K4; germline loss causes Kabuki syndrome and somatic mutation recurs in lymphoma.
KRR1 interacting protein 1
KRR1 interacting protein 1 (Kri1; yeast KRI1/YNL308c, human KRI1) is an essential nucleolar 40S ribosome biogenesis factor that binds the Krr1 KH1 domain; distinct from KRIT1/CCM1.
La-related proteins
La-related proteins (LARPs): conserved eukaryotic RNA-binding protein superfamily with five subfamilies (genuine La/LARP3, LARP1, LARP4, LARP6, LARP7), defined by the La module (LaM+RRM1), acting in RNA processing, 7SK snRNP assembly, and TOP mRNA translation regulation.
LARP1
LARP1 (La ribonucleoprotein 1, translational regulator; LARP1a) is a human 1096-amino-acid RNA-binding protein on chromosome 5q33.2 that regulates 5'TOP mRNA translation and stability downstream of mTORC1 and is upregulated in cancers.
Leo1-like protein
Leo1-like protein (LEO1) is a subunit of the conserved Paf1/PAF1 complex associated with RNA polymerase II. It binds RNA through Paf1, is phosphorylated by CDK12, and links transcription elongation to DNA repair and development.
Let-7 microRNA precursor
Let-7 microRNA precursor: stem-loop precursor of the let-7 microRNA family, discovered as the lethal-7 heterochronic gene in C. elegans; conserved sequence UGAGGUAGUAGGUUGUAUAGUU, regulated by LIN28/TUT4/7 uridylation, a tumor suppressor targeting RAS, MYC, HMGA2.
LexA repressor
LexA repressor, the lexA gene product of E. coli and many bacteria, represses SOS DNA repair genes at SOS box operators until RecA-ssDNA triggers its autocleavage; absent from mammals, a drug target.
LINC00312
LINC00312, also called NAG7, is a human long non-coding RNA gene at 3p25.3 producing an intronless, single-exon transcript that acts as a tumor suppressor, is downregulated in nasopharyngeal carcinoma and lung cancers, binds DNA-PKcs and YBX1, and modulates chemoradiation sensitivity.
Lipid nanoparticle-mediated base editor delivery
Lipid nanoparticle-mediated base editor delivery is a non-viral method that uses lipid particles to deliver base-editing mRNA and guide RNA into cells, mainly in the liver.
List of RNA-Seq bioinformatics tools
RNA-Seq bioinformatics tools: software for read mapping (STAR, HISAT2), quantification (featureCounts, Salmon, kallisto, RSEM), reconstruction (StringTie, Trinity), and differential analysis (DESeq2, edgeR, DEXSeq, rMATS).
Liver X receptor
Liver X receptors (LXRα/NR1H3, LXRβ/NR1H2) are oxysterol-activated nuclear receptors, RXR heterodimer partners, that regulate cholesterol efflux, bile acid synthesis, lipogenesis, and inflammation.
lncRNA databases
lncRNA databases are specialized catalogs recording the sequences, genomic locations, and functions of long non-coding RNAs, spanning literature-curated resources like lncRNAdb and large catalogs like NONCODE, GreeNC, and LncBook.
lncRNAs in immune signaling and inflammatory disease
Long non-coding RNAs (lncRNAs) in immune signaling are RNA transcripts that regulate NF-κB, interferon, and T-cell pathways, with roles in lupus, multiple sclerosis, and rheumatoid arthritis.
LOB domain-containing protein
LOB domain-containing (LBD/ASL) proteins are plant-specific transcription factors with a ~100 aa LOB domain (CX2CX6CX3C motif, GAS block, leucine zipper); they bind the GCGGCG motif and regulate leaf, root, vascular, and fruit development.
Locus control region
Locus control region (LCR), e.g. the beta-globin LCR or dominant control region: a multi-kilobase cluster of DNase I hypersensitive enhancer sites that confers high-level, position-independent gene expression, studied at the globin loci and used in hemoglobinopathy gene therapy vectors.
Long non-coding RNA
Long non-coding RNA (lncRNA): noncoding RNA transcripts over 200 nucleotides that regulate gene expression as decoys, guides, and scaffolds; examples H19, Xist, HOTAIR, PCA3; used as cancer biomarkers and therapeutic targets.
LSm
LSm (Like-Sm) proteins are RNA-binding proteins with the Sm fold, present in bacteria, archaea, and eukaryotes; eukaryotic LSm1-7 and LSm2-8 heteroheptameric rings handle mRNA decay and U6 snRNA splicing, while bacterial Hfq and archaeal SmAPs form homo-oligomeric rings.
MALAT1
MALAT1 (NEAT2), a ~7-kb nuclear speckle lncRNA at 11q13, stabilized by a 3' triple helix and processed by RNase P/Z into 61-nt mascRNA; abundant (~2,500-3,000 copies/cell), context-dependent in cancer, no clinical trials yet.
MarR-type HTH domain
The MarR-type HTH domain is a winged helix-turn-helix DNA-binding domain of about 135 residues in MarR/SlyA-family regulators, named after E. coli MarR, the multiple antibiotic resistance regulator.
Massively parallel reporter assay
A massively parallel reporter assay (MPRA) is a high-throughput molecular biology method measuring the regulatory activity of thousands to hundreds of thousands of DNA sequences in a single experiment.
Master regulator analysis
Master regulator analysis (MRA) is a computational method in systems biology that infers which transcription factors or signaling proteins drive gene expression differences between two biological conditions.
MBNL1
MBNL1 (muscleblind-like splicing regulator 1) is a human RNA-binding protein with four CCCH zinc fingers that regulates developmental alternative splicing; sequestration by CUG repeat RNA drives myotonic dystrophy type 1, and MBNL1 restoration is a therapeutic strategy.
MECP2
MECP2, also known as methyl CpG binding protein 2, is a gene on the X chromosome whose mutations cause most cases of Rett syndrome, a neurodevelopmental disorder.
Mediator (coactivator)
Mediator (coactivator), also called the TRAP or Mediator transcription complex, is a conserved multi-subunit coactivator of RNA polymerase II transcription with head, middle, tail, and kinase modules, bridging enhancer-bound transcription factors to the pre-initiation complex.
Mediator complex, subunit Med10
MED10 (Mediator complex subunit 10, also NUT2, L6, TRG20) is a 135-aa middle-module component of the Mediator coactivator for RNA polymerase II, essential in yeast, required for zebrafish heart valve and Wnt/Nodal signaling, and implicated in cancer.